Jump to content

LRRC24

From Wikipedia, the free encyclopedia
LRRC24
Identifiers
AliasesLRRC24, LRRC14OS, leucine rich repeat containing 24
External IDsMGI: 3605040; HomoloGene: 86785; GeneCards: LRRC24; OMA:LRRC24 - orthologs
Orthologs
SpeciesHumanMouse
Entrez
Ensembl
UniProt
RefSeq (mRNA)

NM_001024678

NM_198119

RefSeq (protein)

NP_001019849

NP_932787

Location (UCSC)Chr 8: 144.52 – 144.53 MbChr 15: 76.6 – 76.61 Mb
PubMed search[3][4]
Wikidata
View/Edit HumanView/Edit Mouse

Leucine rich repeat containing 24 is a protein that, in humans, is encoded by the LRRC24 gene.[5] The protein is represented by the official symbol LRRC24, and is alternatively known as LRRC14OS.[6] The function of LRRC24 is currently unknown. It is a member of the leucine-rich repeat (LRR) superfamily of proteins.

Gene

[edit]

In humans, LRRC24 is located on Chromosome 8 (8q24.3). The gene spans approximately 4.66 kb on the opposite strand.[5] LRRC24 is composed of five exons, and only a single gene isoform has been identified.[5]

GeneCards Genomic View for LRRC24 gene[6]

Protein

[edit]

General features

[edit]

LRRC24 is a transmembrane protein of unknown function. Human LRRC24 consists of 513 amino acids including a 23 amino acid signal peptide.[5][7] The mature form of the protein has a molecular weight of 52.9 kDa.[8] The isoelectric point of the mature human protein is 7.98[9] The protein is largely composed of alpha helices.[10]

Domains

[edit]

LRRC24 is a single-pass transmembrane protein. The protein consists of six leucine-rich repeats and an immunoglobulin-like domain.[5][11]

Feature Position(s) Description
Signal Peptide 1-23 [12]
Domain 24-50 Leucine rich repeat N-terminal domain (LRRNT)[13][14]
Repeat 51-72 Leucine rich repeat 1 (LRR 1)[13][14]
Repeat 75-96 LRR 2[13][14]
Repeat 99-120 LRR 3[13][14]
Repeat 123-144 LRR 4[13][14]
Repeat 147-168 LRR 5[13][14]
Repeat 171-192 LRR 6[13][14]
Domain 204-257 Leucine rich repeat C-terminal domain (LRRCT)[13][14]
Domain 259-364 Immunoglobulin-like domain (Ig-like)[13][14]
Domain 406-426 Transmembrane domain (TMEM)[15]
Motif 427-436 Arginine-rich motif (ARM)[13]
Diagram of LRRC24. Domains are labelled as predicted;[16] grey markers represent confirmed N-linked glycosylated arginine residues (N334 & N363); red marker represents confirmed phorphorylated tyrosine (Y509); Figure created using Prosite MyDomains-Image Creator[17]

Localization

[edit]

LRRC24 is a secreted protein as is evidenced by the presence of a signal peptide. The structure of the protein suggests that it localizes to the cell membrane.

Homology

[edit]

LRRC24 is conserved in Euteleostomi with the exception of Aves.[5][18] Also, based on sequence homology analysis, distant orthologs of LRRC24 are also conserved in invertebrates of phyla Mollusca and Arthropoda.[5] No human paralogs of LRRC24 have been identified.

An unrooted phylogenetic tree of LRRC24 orthologs generated using Phylip’s DrawTree[16] and ClustalW.[9][19]

Expression

[edit]

Microarray and in situ hybridization experiments suggest LRRC24 is primarily expressed within the brain.[20][21][22] Expression is observed to be especially high within the midbrain, neocortex, and tissues of the limbic system, including the hypothalamus and hippocampal formation.[20][22][23]

Interactions

[edit]

Protein-protein interactions of LRRC24 implicate the protein with cell signaling, cell migration, and axon guidance. ROBO2 was found to interact with LRRC24.[24][25] ROBO2 is a member of the Roundabout gene family, which are well known to play a significant role in nervous system development. Also, LRRC24 was found to interact with LRRTM4, a protein believed to be involved in synaptogenesis, as well as the maintenance of the nervous system in vertebrates.[25]

LRRC24 has also been found to interact with IGFBP7, a known regulator of insulin-like growth factors (IGFs).[25] IGFBP7 is also involved in the stimulation of cell adhesion.

Clinical significance

[edit]

To date, no study has specifically implicated LRRC24 or the LRRC24 gene with any case of clinical significance.[26]

References

[edit]
  1. ^ a b c GRCh38: Ensembl release 89: ENSG00000254402Ensembl, May 2017
  2. ^ a b c GRCm38: Ensembl release 89: ENSMUSG00000033707Ensembl, May 2017
  3. ^ "Human PubMed Reference:". National Center for Biotechnology Information, U.S. National Library of Medicine.
  4. ^ "Mouse PubMed Reference:". National Center for Biotechnology Information, U.S. National Library of Medicine.
  5. ^ a b c d e f g "LRRC24 leucine rich repeat containing 24 [Homo sapiens (human)] - Gene - NCBI". www.ncbi.nlm.nih.gov. Retrieved 2016-02-29.
  6. ^ a b "GeneCard". www.genecards.org. Retrieved 2016-05-09.
  7. ^ "LRRC24 Gene (Protein Coding)". genecards.com. Retrieved February 22, 2016.
  8. ^ Brendel V, Bucher P, Nourbakhsh IR, Blaisdell BE, Karlin S (March 1992). "Methods and algorithms for statistical analysis of protein sequences". Proceedings of the National Academy of Sciences of the United States of America. 89 (6): 2002–6. Bibcode:1992PNAS...89.2002B. doi:10.1073/pnas.89.6.2002. PMC 48584. PMID 1549558.
  9. ^ a b Kozlowski LP (October 2016). "IPC - Isoelectric Point Calculator". Biology Direct. 11 (1): 55. doi:10.1186/s13062-016-0159-9. PMC 5075173. PMID 27769290.
  10. ^ Borrelli KW, Vitalis A, Alcantara R, Guallar V (November 2005). "PELE: Protein Energy Landscape Exploration. A Novel Monte Carlo Based Technique". Journal of Chemical Theory and Computation. 1 (6): 1304–11. doi:10.1021/ct0501811. PMID 26631674.
  11. ^ "LRRC24 - Leucine-rich repeat-containing protein 24 precursor - Homo sapiens (Human) - LRRC24 gene & protein". www.uniprot.org. Retrieved 2016-02-29.
  12. ^ Petersen TN, Brunak S, von Heijne G, Nielsen H (September 2011). "SignalP 4.0: discriminating signal peptides from transmembrane regions". Nature Methods. 8 (10): 785–6. doi:10.1038/nmeth.1701. PMID 21959131. S2CID 16509924.
  13. ^ a b c d e f g h i j "LRRC24 - Leucine-rich repeat-containing protein 24 precursor - Homo sapiens (Human) - LRRC24 gene & protein". www.uniprot.org. Retrieved 2016-05-09.
  14. ^ a b c d e f g h i "NCBI Conserved Domain Search". www.ncbi.nlm.nih.gov. Retrieved 2016-05-09.
  15. ^ Krogh A, Larsson B, von Heijne G, Sonnhammer EL (January 2001). "Predicting transmembrane protein topology with a hidden Markov model: application to complete genomes". Journal of Molecular Biology. 305 (3): 567–80. doi:10.1006/jmbi.2000.4315. PMID 11152613.
  16. ^ a b "LRRC24 leucine rich repeat containing 24 [Homo sapiens (human)] - Gene - NCBI". www.ncbi.nlm.nih.gov. Retrieved 2016-05-09.
  17. ^ SIB Swiss Institute of Bioinformatics. "Prosite MyDomains - Image Creator".
  18. ^ "HomoloGene - NCBI". www.ncbi.nlm.nih.gov. Archived from the original on September 15, 2016. Retrieved 2016-05-09.
  19. ^ Thompson JD, Higgins DG, Gibson TJ (November 1994). "CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice". Nucleic Acids Research. 22 (22): 4673–80. doi:10.1093/nar/22.22.4673. PMC 308517. PMID 7984417.
  20. ^ a b "GDS868 / GATCCATTGCTGAGCTTGCG". www.ncbi.nlm.nih.gov. Retrieved 2016-05-09.
  21. ^ "GDS3142 / 1433876_at". www.ncbi.nlm.nih.gov. Retrieved 2016-05-09.
  22. ^ a b "GDS3917 / 1433876_at". www.ncbi.nlm.nih.gov. Retrieved 2016-05-09.
  23. ^ "Experiment Detail :: Allen Brain Atlas: Mouse Brain". mouse.brain-map.org. Retrieved 2016-05-09.
  24. ^ Gilsohn E, Volk T (2010-01-01). "Fine tuning cellular recognition: The function of the leucine rich repeat (LRR) trans-membrane protein, LRT, in muscle targeting to tendon cells". Cell Adhesion & Migration. 4 (3): 368–71. doi:10.4161/cam.4.3.11606. PMC 2958611. PMID 20404543.
  25. ^ a b c Söllner C, Wright GJ (2009-01-01). "A cell surface interaction network of neural leucine-rich repeat receptors". Genome Biology. 10 (9): R99. doi:10.1186/gb-2009-10-9-r99. PMC 2768988. PMID 19765300.
  26. ^ "Home - dbVar - NCBI". www.ncbi.nlm.nih.gov. Retrieved 2016-05-09.